Cell Signaling pUC/M13 Sequencing Primers Product pUC/M13 Primer, Forward (17mer) pUC/M13 Primer, Reverse (17mer) pUC/M13 Primer, Reverse (22mer) pUC/M13 Primer, Forward (24mer) Size Conc. Cat.# Price (Fr) 2 µg 10 µg/ml Q5391 135.00 2 µg 10 µg/ml Q5401 135.00 2 µg 10 µg/ml Q5421 135.00 2 µg 10 µg/ml Q5601 135.00 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The pUC/M13 Primers are designed for sequencing inserts cloned into the M13 vectors and pUC plasmids developed by Messing. These primers also can be used for sequencing other lacZ-containing plasmids such as the pGEM®-Z and pGEM®-Zf Vectors. The primers are purified by gel electrophoresis or HPLC. Primer Sequences • Forward (17mer): 5´-d(GTTTTCCCAGTCACGAC)-3´ • Reverse (17mer): 5´-d(CAGGAAACAGCTATGAC)-3´ • Reverse (22mer): 5´-d(TCACACAGGAAACAGCTATGAC)-3´ • Forward (24mer): 5´-d(CGCCAGGGTTTTCCCAGTCACGAC)-3´ Storage Conditions: Store at –20°C. The primers are supplied in sterile water. T-Vectors pGEM®-T Vector Systems Product pGEM®-T Vector System I pGEM®-T Vector System II Size Cat.# Price (Fr) 20 reactions A3600 289.00 20 reactions A3610 527.00 For Research Use Only. Not for Use in Diagnostic Procedures. For additional information see page 221. XmnI 1994 ScaI 1875 f1 ori Ampr pGEM® Vector (3000bp) -T NaeI 2692 T7 lacZ T T ApaI AatII SphI BstZI NcoI SacII ori SpeI NotI BstZI PstI SalI NdeI SacI BstXI NsiI SP6 14 20 26 31 37 46 103 112 55 62 62 73 75 82 94 126 1 start ori Ampr Enhancer/Promoter Intron CMV pTARGET™ Vector (5670bp) Synthetic poly(A) Neo BglII 5665 SgfI 664 I-PpoI 851 T T SV40 Late poly (A) fl ori SV40 Enhancer/ EarlyPromoter lacZ T7 EcoRI BamHI NheI XhoI MluI SmaI KpnI SalI AccI NotI 1250 1256 1264 1270 1276 T overhangs EcoRI lacZ 1293 1301 1303 1304 1311 1318 pGEM®-T Easy Vector Systems Product pGEM®-T Easy Vector System I pGEM®-T Easy Vector System II Size Cat.# Price (Fr) 20 reactions A1360 318.00 20 reactions A1380 556.00 For Research Use Only. Not for Use in Diagnostic Procedures. For additional information see page 221. XmnI 2009 ScaI 1890 f1 ori Ampr pGEM®-T Easy Vector (3015bp) lacZ NaeI 2707 T7 T T ApaI AatII SphI BstZI NcoI BstZI NotI SacII EcoRI ori SpeI EcoRI NotI BstZI PstI SalI NdeI SacI BstXI NsiI SP6 14 20 26 31 37 43 43 49 52 1 start 18 109 118 127 141 64 70 77 77 88 90 97 pTargeT™ Mammalian Expression Vector System Product pTARGET™ Mammalian Expression Vector System For Research Use Only. Not for Use in Diagnostic Procedures. For additional information see page 222. Size Cat.# Price (Fr) 20 reactions A1410 850.00 For complete and up-to-date product information visit: www.promega.com/catalog 311 Vectors     0356VA04_3A  1473VA05_6A 1505VA07_6A Pagina 314

Pagina 316

Scoor meer met een webshop in uw archief. Velen gingen u voor en publiceerden catalogussen online.

Promega Switzerland - Life Sciences Catalog 2012 Lees publicatie 100Home