Cell Signaling T3 RNA Polymerase Product T3 RNA Polymerase T3 RNA Polymerase (HC) For Laboratory Use. Size Conc. Cat.# Price (Fr) 1,000 u 10–20 u/µl P2083 122.00 2,500 u 80 u/µl P4024 229.00 Description: T3 RNA Polymerase is a DNA-dependent RNA polymerase that exhibits extremely high specificity for its cognate promoter sequences. Only T3 DNA or DNA cloned downstream from a T3 promoter can serve as a template for T3 RNA Polymerase-directed RNA synthesis. Features: • Specific: T3 RNA Polymerase exhibits extremely high affinity and specificity for T3 promoter sequences. • Highly Pure: T3 RNA Polymerase is >90% pure as determined by SDS polyacrylamide gel electrophoresis. Free of detectable levels of contaminating RNase and DNase activity (<1% release). • Flexible: Will incorporate 32P, 33P, 3H and 35S nucleoside triphosphates. • Provided with 5X Reaction Buffer: Provided with 100mM DTT and Transcription Optimized 5X Buffer: 200mM Tris-HCl (pH 7.9 at 25°C), 30mM MgCl2, 10mM spermidine, 50mM NaCl. • Choose Your Configuration: Learn more about our custom options for this product at: www.promega.com/myway/ Storage Conditions: Store at –20°C. Protocol T3 RNA Polymerase Protocol T7 RNA Polymerase Product T7 RNA Polymerase T7 RNA Polymerase (HC) For Laboratory Use. Size Conc. Cat.# Price (Fr) 1,000 u 10–20 u/µl P2075 122.00 5,000 u 10–20 u/µl P2077 473.00 10,000 u 80 u/µl P4074 710.00 Description: T7 RNA Polymerase is a DNA-dependent RNA polymerase that exhibits extremely high specificity for its cognate promoter sequences. Only T7 DNA or DNA cloned downstream from a T7 promoter can serve as a template for T7 RNA Polymerase-directed RNA synthesis. Features: • Specific: T7 RNA Polymerase exhibits extremely high affinity and specificity for T7 promoter sequences. • Highly Pure: T7 RNA Polymerase is judged to be greater than 90% pure as determined by SDS polyacrylamide gel electrophoresis. Free of detectable levels of contaminating RNase and DNase activity (<1% release). • Flexible: Will incorporate 32P, 33P, 3H and 35S nucleoside triphosphates. • Provided with 5X Reaction Buffer: Provided with 100mM DTT and Transcription Optimized 5X Buffer: 200mM Tris-HCl (pH 7.9 at 25°C), 30mM MgCl2, 10mM spermidine, 50mM NaCl. • Choose Your Configuration: Learn more about our custom options for this product at: www.promega.com/myway/ Storage Conditions: Store at –20°C. Protocol T7 RNA Polymerase Protocol Part# 9PIP207 Part# 9PIP208 RNA Polymerase Promoter Sequencing Primers Product SP6 Promoter Primer T7 Promoter Primer T7 EEV Promoter Primer Size Conc. Cat.# Price (Fr) 2 µg 10 µg/ml Q5011 156.00 2 µg 10 µg/ml Q5021 156.00 2 µg 10 µg/ml Q6700 135.00 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The SP6 and T7 Promoter Primers are designed for sequencing inserts cloned into the pGEM® Vectors. The SP6 Promoter Primer is designed for sequencing inserts cloned into the pALTER®-MAX and pCI-neo Vectors. The primers are designed to be annealed to single-stranded DNA or, after alkaline denaturation, to double-stranded DNA. The promoter primers are purified by gel electrophoresis or HPLC. The T7 EEV Promoter Primer is suitable for sequencing the pALTER®-MAX, pCMVTNT™, pTNT™ and phMGFP Vectors, and the pCI/pSI series of mammalian expression vectors. Primer Sequences • SP6: 5´-d(TATTTAGGTGACACTATAG)-3´ • T7: 5´-d(TAATACGACTCACTATAGGG)-3´ • T7 EEV: 5´-d(AAGGCTAGAGTACTTAATACGA)-3´ Storage Conditions: Store at –20°C. 4 For complete and up-to-date product information visit: www.promega.com/catalog 91 Cloning and DNA Markers Pagina 94
Pagina 96Interactieve digi magazine, deze boek of verenigingsblad is levensecht online geplaatst met Online Touch en bied het van pdf naar digitaal converteren van web vakbladen.
Promega Switzerland - Life Sciences Catalog 2012 Lees publicatie 100Home